HOME | DD

Description
April 1, 2100000000 BCE; Lerova Ocean

Tick tick tick tick tick tick tick tick tick tick tick…

The eternal process slid along. The helix unraveled twist by twist as the helicase enzyme slid down the rungs of the nucleotide ladder, unzipping the base pairs one by one. For each unzipped unit, the DNA polymerase followed the rows it was being fed. It did as it always did, matching the broken pairs with new companions on each side. Adenine to Uracil. Cytosine to Guanine. Guanine to Cytosine. Thymine to Adenine.

CCGACACCGATGCACAGGAGAATCCATACTACAAATAAACACAGGCATATGCAGACACACCCCACACATACTACAAGTAGAACGACTCAT

Piece by piece, two new ladders were assembled from one. Their helices coiled back onto themselves, and took their places at opposite sides of the cytoplasm. The membrane encasing the entire intricate process began to tug at itself, creating faint little pulses and ripples in the primordial soup around it. This tiny little unit, this small encased bubble of life, this singular cell, began the process that generations of its mothers before it had been doing for the past couple billions of years. Slowly but surely, its membrane began to stretch and pull in a tug of war against itself. The two bundled of copied DNA stayed huddled on opposite ends, taking care to stay far away from the pinching that was occurring in the middle of the cell. The two ends began to take shape as their connecting membrane pinched tighter and tighter onto itself. They stopped wiggling in symmetry and started wiggling independently, to their own beat. They each pulled against one another, closing the pinch tighter and tighter. Until finally the membrane met itself at a single point, and the connection was severed.

The two daughter cells slowly wriggled away from the point of their creation where their mother once laid. They swam close together, reforming their individual ribosomes and bundling their packets of newly copied DNA back into the centers of their gelatinous little bodies. They were alive, sisters in genomes, free to continue the beautiful cycle of existence.

But it wasn't a very comfortable existence. It was cold in the depths of the Lerova Ocean, colder than these little archaea would prefer. The water was littered with it's own crystalline death traps. Spikes of ice surrounded their birthplace, and indeed they surrounded the entire planet. It had been like this for a while. Ever since the cyanobacteria arrived and choked the planet in their excretions. They had evolved to cope in a world dominated by purple. They picked up the other colors that the great lifegiver, the shining sun, put out besides the abundant green that the halobacteria had monopolized on. But in order to do that, they had to have different chemistry churning inside of them. They used chlorophyll to convert the sun's rays into energy, a much more efficient reaction than the retinal of the lavender lifeforms. Their niche survival strategy soon gave them the tools to take over the world and rule it themselves.

But the cost was dreadful. Their photosynthetic progress pumped ton after ton of oxygen into the environment. First in the oceans, which turned a deep blood red as the oxygen rusted the iron floating within. Then in the sky, where the oxygen accumulated into a thick layer of metabolic toxin. It was too much for most other lifeforms on the planet to handle. Oxygen was poison. Their chemistry wasn't designed to handle it, let alone in this terrifying new amount. And so was the fate of many of these two sisters' mother cells going back generations. Many of them were choked out, poisoned by these new rulers of the world, and the survivors were left to swim in the wasteland left behind.

In some ways the hubris of the cyanobacteria was met with a sort of karma. In their hunger, they removed most of the carbon dioxide from the atmosphere, and the oxygen in the air removed the methane as well. Earth's greenhouse shield was gone. And so came the ice. All over the world, for miles upon miles, the planet began to freeze to death. If any surviving life had a difficult time beforehand, now it was even worse. And even the cyanobacteria, rulers of the world, the ones responsible for this very situation, were beginning to die out as a result.

But despite the trials of being alive, the archaea sisters pushed on just like their ancestors did, fighting to make a living despite the tyrannical environment crafted by the world's ruling organisms.

The sisters carefully navigated through the icy waters together, pushing gracefully through the rusty fluid between the crystals. Until finally, they came across something spectacular. They came across a clearing. A tiny little pinprick of open water where the sun could shine its rays down into and fuel an oasis. It was beautiful. Sunbeams illuminated a swarm of other microbes paddling along and snatching each other up for food. Some had eyespots, dilating as they passed through the beams. Others had little cilia, pushing them along. And then there were those which the sisters found most delicious: the Rickettsiales. These bacteria were rich with energy given their ability to make ATP so efficiently. The best prey to fuel another day to live.

And so the sisters entered the oasis, and began to enjoy themselves. They paddled into the wake of fluttering microbes, and readied their strikes. One sister saddled up next to an unsuspecting bacterium, and her pseudopod bulged out a little towards it. She inched closer, and closer, and then, before the bacterium had a chance to notice her presence…

Snick!

A small spicule erupted from the sister's membrane and punctured into her prey. The sharp organelle pierced the bacterium's membrane and brought its life to a swift end. The kill was clean, and the sister retracted her hidden weapon. Then she moved forward, and slowly wrapped herself around her prey, dragging it into her cytoplasm so that her inner chemistry could make quick work of its molecules.

As her digestion finished up, she turned back in the direction of her sister, hoping to join in on the high concentration of food. She paddled past the other microbes, blending amongst the crowd. Her sister was right ahead of her, towards the edge of the clearing, using her hidden spicules to catch prey just as she had. This was a good place, their mother would've been very comfortable here. Perhaps the sisters would be able to bring their own daughters into the world here.

But wait… something started feeling off. The paddling sister detected a sort of disturbance in the chemistry in the water around her. It wasn't much at first, but it was uncomfortable. Her sister ahead seemed to feel it too. She paused her feeding and jerked a little. Whatever it was was getting worse. Many of the other microbes sensed it too. Some of them started spazzing out and choked to death on the spot. The paddling sister stopped paddling, opting to try and back away slowly.

Then the green began to emerge from between the jagged ice crystals. Tendrils of linked balls of algae stretched out menacingly between the ice. They leached out until they were able to come back together into a whole cluster. The ones on the edges wiggled around the oasis, searching for the sunlight and protruding into it when they detected it. The cyanobacteria had found a new spot to claim for their kingdom. They came to rule.

The paddling sister backed away as quickly as she could. The oxygen was already becoming too much to bear. The cyanobacteria consumed the space of the oasis, pushing aside all the dead carcasses of the other microbes.

And the little archaea's sister, the one that had been enjoying her meal not long before, was struggling to hold on. She had been too close to get away fast enough. She struggled and spazzed, trying to use what little energy and chemical resources she could to push herself away, but it wasn't enough. The oxygen was clogging all of her respiration. All her machinery was clanking against itself. Until, eventually, it couldn't do it anymore. The sister jerked, slower and slower. And then she was still. Her motionless membrane went flat, and began to drift slowly downwards. She was gone.

There was only one survivor left. Her sister kept paddling with all her ability. She darted into the closest hole in the ice crystals, and paddled away down the tunnel as fast as she could, getting far, far away from the monstrous cluster of green.

She was alone now. Her sister was gone. Her food was gone. Her oasis was taken from her.

She fled, alone, feeling weak and slow. She had used up so much energy escaping the monster. Her membrane was still choked a little from residual oxygen. It didn't look good for her. She needed to eat. She paddled along until she detected other microbes floating through the ice tunnels with her. But there were not many of them. And the ones that were there, they were too fast. Their cilia and flagella carried them far away from the reach of the sister's hidden weapons, let alone her membrane. She tried, but that only wasted more energy. She was dying. She didn't have enough to go on now, all thanks to those green beasts.

She began to slow. Her paddling was getting closer and closer to stopping altogether. Her innards wheezed. There was a bacterium ahead of her, she detected. A Rickettsiale. It was floating towards her, but she didn't have the energy to snatch it anymore. She didn't have the energy to do much at all. It seemed her lineage would end here. She would soon join her sister.

Her movement stopped there in the middle of the water as she awaited the end. The bacterium drifted closer and closer towards her. Carried by the current, it soon found itself bumping into the side of her membrane. It got stuck there, but it didn't seem to put up any struggle. The sister began to slowly drag it into herself, using the last of her energy to at least get one more meal. Her membrane surrounded the tiny little organism, until it was submerged fully inside her cytoplasm. But that was the last she was able to do. Her energy was gone. She didn't even have the capacity to digest anymore. And so she sat there, awaiting until the countdown to the end took her at last…

Tick…

Tick……

Tick…

Tick?

The countdown suddenly stopped. Something was odd. She felt odd. But… a good odd. Something in her chemistry was almost… reawakening. She felt energy return to her. She felt that choking feeling vanish as all her machinery suddenly kicked into high gear. What was going on? What was supplying this newfound life?

The Rickettsiale. It was pumping away, doing its own thing while inside the sister. It was munching on the leftovers from her previous meal, and pumping out ATP in return. Not only that, but it was using that residual oxygen that had been killing her to make the process go even better. It was sitting nice and comfortable inside its new host, and in return for that comfort it was pumping out all of its leftovers to her. It was a positive feedback loop. Her energy had been restored! She felt alive! This new team was a miracle! As one organism, they were so much stronger. This little Rickettsiale had saved her life. It made her feel even more stronger than she ever had.

It was the powerhouse of the cell!

Flipping end over end in rejuvenation, the sister began to swim back in the direction of the cyanobacteria cluster. She began to feel the change in chemistry again as the oxygen cloud enveloped her. But instead of making her feel weak this time, it made her feel revived. All that oxygen went to the Rickettsiale inside of her, and it pumped out more energy for the both of them as a result. She had no reason to fear the tyrants anymore. She could bring them off their throne.

She came face to face with one of the tendrils of the cluster that was busy leeching energy from the sunlight in the oasis. It seemed to ignore her, like she was simply another microbe. But she wasn't that anymore. She was something different, something new. The cyanobacteria's excretions didn't choke her anymore. Her Rickettsiale friend simply took it as fuel to help her with her next action: striking.

Snick!

Her hidden spicule jutted out from her membrane and punctured the edge of the cyanobacteria. The algal tendril recoiled a little bit, not used to such an attack. The cell that the sister punctured immediately shriveled as she drew it in towards her mouth to consume. Her spicule retracted, and she inched onwards to the next cell of cyanobacteria. One after another, the clump began to shrink. It began to fall apart as the individual cells realized that this was no longer a place where their dominance held any sway. This new creature, this assassin of an organism, was devouring it and reclaiming the oasis as hers. The tendrils of the green beast unravelled and scurried away between the cracks in the ice. They dispersed, defeated, and soon the sunlight shone onto a newly empty oasis once more.

The sister had liberated her home. She did it together with her new friend inside of her. They were a team now, inseparable after the revelation of such a beneficial symbiotic relationship. And so it was that in the midst of all the other microbes scurrying back into the oasis that their liberated had won back for them to call home in, the sister did not perform her final action alone.

Tick tick tick tick tick tick tick tick tick tick tick…

The eternal process slid along again. The sister's helices began to unravel twist by twist as her helicase enzyme slid down the rungs of her nucleotide ladder, unzipping the base pairs one by one. And the same process began to start within the Rickettsiale too, synched together with the motions of its host's mitosis. One after another, their DNA strands were copied within themselves. Their nucleotide ladders began to coil back onto themselves, and huddled together at the ends of their membranes. The Rickettsiale split into two new sisters first, and then those two sisters took their place on opposite ends of the archaea sister alongside her own DNA. The sister pulled on herself, the membrane competing in it's own tug of war. The membrane pinched together, tighter and tighter, each side encapsulating their own identical chemistry.

And then finally, sisters. Emergent new life born of their mothers. Not just daughters of the old archaea, but the Rickettsiale within. They travelled together, not as two organisms but as one with a common drive and a mutual benefit. Sisters had not been born this time. This time, a sisterhood was born. And it would be one on which a new, very different future for life could be built upon.

ATCATGCATACTAGAATCACGAGACAGCATCACCCAACAACACCCACACACCGACATACTAGAATCACGAGACAGATTACACACATAAGACATCATACAAAT

Description
April 1, 2100000000 BCE; Lerova Ocean

Tick tick tick tick tick tick tick tick tick tick tick…

The eternal process slid along. The helix unraveled twist by twist as the helicase enzyme slid down the rungs of the nucleotide ladder, unzipping the base pairs one by one. For each unzipped unit, the DNA polymerase followed the rows it was being fed. It did as it always did, matching the broken pairs with new companions on each side. Adenine to Uracil. Cytosine to Guanine. Guanine to Cytosine. Thymine to Adenine.

CCGACACCGATGCACAGGAGAATCCATACTACAAATAAACACAGGCATATGCAGACACACCCCACACATACTACAAGTAGAACGACTCAT

Piece by piece, two new ladders were assembled from one. Their helices coiled back onto themselves, and took their places at opposite sides of the cytoplasm. The membrane encasing the entire intricate process began to tug at itself, creating faint little pulses and ripples in the primordial soup around it. This tiny little unit, this small encased bubble of life, this singular cell, began the process that generations of its mothers before it had been doing for the past couple billions of years. Slowly but surely, its membrane began to stretch and pull in a tug of war against itself. The two bundled of copied DNA stayed huddled on opposite ends, taking care to stay far away from the pinching that was occurring in the middle of the cell. The two ends began to take shape as their connecting membrane pinched tighter and tighter onto itself. They stopped wiggling in symmetry and started wiggling independently, to their own beat. They each pulled against one another, closing the pinch tighter and tighter. Until finally the membrane met itself at a single point, and the connection was severed.

The two daughter cells slowly wriggled away from the point of their creation where their mother once laid. They swam close together, reforming their individual ribosomes and bundling their packets of newly copied DNA back into the centers of their gelatinous little bodies. They were alive, sisters in genomes, free to continue the beautiful cycle of existence.

But it wasn't a very comfortable existence. It was cold in the depths of the Lerova Ocean, colder than these little archaea would prefer. The water was littered with it's own crystalline death traps. Spikes of ice surrounded their birthplace, and indeed they surrounded the entire planet. It had been like this for a while. Ever since the cyanobacteria arrived and choked the planet in their excretions. They had evolved to cope in a world dominated by purple. They picked up the other colors that the great lifegiver, the shining sun, put out besides the abundant green that the halobacteria had monopolized on. But in order to do that, they had to have different chemistry churning inside of them. They used chlorophyll to convert the sun's rays into energy, a much more efficient reaction than the retinal of the lavender lifeforms. Their niche survival strategy soon gave them the tools to take over the world and rule it themselves.

But the cost was dreadful. Their photosynthetic progress pumped ton after ton of oxygen into the environment. First in the oceans, which turned a deep blood red as the oxygen rusted the iron floating within. Then in the sky, where the oxygen accumulated into a thick layer of metabolic toxin. It was too much for most other lifeforms on the planet to handle. Oxygen was poison. Their chemistry wasn't designed to handle it, let alone in this terrifying new amount. And so was the fate of many of these two sisters' mother cells going back generations. Many of them were choked out, poisoned by these new rulers of the world, and the survivors were left to swim in the wasteland left behind.

In some ways the hubris of the cyanobacteria was met with a sort of karma. In their hunger, they removed most of the carbon dioxide from the atmosphere, and the oxygen in the air removed the methane as well. Earth's greenhouse shield was gone. And so came the ice. All over the world, for miles upon miles, the planet began to freeze to death. If any surviving life had a difficult time beforehand, now it was even worse. And even the cyanobacteria, rulers of the world, the ones responsible for this very situation, were beginning to die out as a result.

But despite the trials of being alive, the archaea sisters pushed on just like their ancestors did, fighting to make a living despite the tyrannical environment crafted by the world's ruling organisms.

The sisters carefully navigated through the icy waters together, pushing gracefully through the rusty fluid between the crystals. Until finally, they came across something spectacular. They came across a clearing. A tiny little pinprick of open water where the sun could shine its rays down into and fuel an oasis. It was beautiful. Sunbeams illuminated a swarm of other microbes paddling along and snatching each other up for food. Some had eyespots, dilating as they passed through the beams. Others had little cilia, pushing them along. And then there were those which the sisters found most delicious: the Rickettsiales. These bacteria were rich with energy given their ability to make ATP so efficiently. The best prey to fuel another day to live.

And so the sisters entered the oasis, and began to enjoy themselves. They paddled into the wake of fluttering microbes, and readied their strikes. One sister saddled up next to an unsuspecting bacterium, and her pseudopod bulged out a little towards it. She inched closer, and closer, and then, before the bacterium had a chance to notice her presence…

Snick!

A small spicule erupted from the sister's membrane and punctured into her prey. The sharp organelle pierced the bacterium's membrane and brought its life to a swift end. The kill was clean, and the sister retracted her hidden weapon. Then she moved forward, and slowly wrapped herself around her prey, dragging it into her cytoplasm so that her inner chemistry could make quick work of its molecules.

As her digestion finished up, she turned back in the direction of her sister, hoping to join in on the high concentration of food. She paddled past the other microbes, blending amongst the crowd. Her sister was right ahead of her, towards the edge of the clearing, using her hidden spicules to catch prey just as she had. This was a good place, their mother would've been very comfortable here. Perhaps the sisters would be able to bring their own daughters into the world here.

But wait… something started feeling off. The paddling sister detected a sort of disturbance in the chemistry in the water around her. It wasn't much at first, but it was uncomfortable. Her sister ahead seemed to feel it too. She paused her feeding and jerked a little. Whatever it was was getting worse. Many of the other microbes sensed it too. Some of them started spazzing out and choked to death on the spot. The paddling sister stopped paddling, opting to try and back away slowly.

Then the green began to emerge from between the jagged ice crystals. Tendrils of linked balls of algae stretched out menacingly between the ice. They leached out until they were able to come back together into a whole cluster. The ones on the edges wiggled around the oasis, searching for the sunlight and protruding into it when they detected it. The cyanobacteria had found a new spot to claim for their kingdom. They came to rule.

The paddling sister backed away as quickly as she could. The oxygen was already becoming too much to bear. The cyanobacteria consumed the space of the oasis, pushing aside all the dead carcasses of the other microbes.

And the little archaea's sister, the one that had been enjoying her meal not long before, was struggling to hold on. She had been too close to get away fast enough. She struggled and spazzed, trying to use what little energy and chemical resources she could to push herself away, but it wasn't enough. The oxygen was clogging all of her respiration. All her machinery was clanking against itself. Until, eventually, it couldn't do it anymore. The sister jerked, slower and slower. And then she was still. Her motionless membrane went flat, and began to drift slowly downwards. She was gone.

There was only one survivor left. Her sister kept paddling with all her ability. She darted into the closest hole in the ice crystals, and paddled away down the tunnel as fast as she could, getting far, far away from the monstrous cluster of green.

She was alone now. Her sister was gone. Her food was gone. Her oasis was taken from her.

She fled, alone, feeling weak and slow. She had used up so much energy escaping the monster. Her membrane was still choked a little from residual oxygen. It didn't look good for her. She needed to eat. She paddled along until she detected other microbes floating through the ice tunnels with her. But there were not many of them. And the ones that were there, they were too fast. Their cilia and flagella carried them far away from the reach of the sister's hidden weapons, let alone her membrane. She tried, but that only wasted more energy. She was dying. She didn't have enough to go on now, all thanks to those green beasts.

She began to slow. Her paddling was getting closer and closer to stopping altogether. Her innards wheezed. There was a bacterium ahead of her, she detected. A Rickettsiale. It was floating towards her, but she didn't have the energy to snatch it anymore. She didn't have the energy to do much at all. It seemed her lineage would end here. She would soon join her sister.

Her movement stopped there in the middle of the water as she awaited the end. The bacterium drifted closer and closer towards her. Carried by the current, it soon found itself bumping into the side of her membrane. It got stuck there, but it didn't seem to put up any struggle. The sister began to slowly drag it into herself, using the last of her energy to at least get one more meal. Her membrane surrounded the tiny little organism, until it was submerged fully inside her cytoplasm. But that was the last she was able to do. Her energy was gone. She didn't even have the capacity to digest anymore. And so she sat there, awaiting until the countdown to the end took her at last…

Tick…

Tick……

Tick…

Tick?

The countdown suddenly stopped. Something was odd. She felt odd. But… a good odd. Something in her chemistry was almost… reawakening. She felt energy return to her. She felt that choking feeling vanish as all her machinery suddenly kicked into high gear. What was going on? What was supplying this newfound life?

The Rickettsiale. It was pumping away, doing its own thing while inside the sister. It was munching on the leftovers from her previous meal, and pumping out ATP in return. Not only that, but it was using that residual oxygen that had been killing her to make the process go even better. It was sitting nice and comfortable inside its new host, and in return for that comfort it was pumping out all of its leftovers to her. It was a positive feedback loop. Her energy had been restored! She felt alive! This new team was a miracle! As one organism, they were so much stronger. This little Rickettsiale had saved her life. It made her feel even more stronger than she ever had.

It was the powerhouse of the cell!

Flipping end over end in rejuvenation, the sister began to swim back in the direction of the cyanobacteria cluster. She began to feel the change in chemistry again as the oxygen cloud enveloped her. But instead of making her feel weak this time, it made her feel revived. All that oxygen went to the Rickettsiale inside of her, and it pumped out more energy for the both of them as a result. She had no reason to fear the tyrants anymore. She could bring them off their throne.

She came face to face with one of the tendrils of the cluster that was busy leeching energy from the sunlight in the oasis. It seemed to ignore her, like she was simply another microbe. But she wasn't that anymore. She was something different, something new. The cyanobacteria's excretions didn't choke her anymore. Her Rickettsiale friend simply took it as fuel to help her with her next action: striking.

Snick!

Her hidden spicule jutted out from her membrane and punctured the edge of the cyanobacteria. The algal tendril recoiled a little bit, not used to such an attack. The cell that the sister punctured immediately shriveled as she drew it in towards her mouth to consume. Her spicule retracted, and she inched onwards to the next cell of cyanobacteria. One after another, the clump began to shrink. It began to fall apart as the individual cells realized that this was no longer a place where their dominance held any sway. This new creature, this assassin of an organism, was devouring it and reclaiming the oasis as hers. The tendrils of the green beast unravelled and scurried away between the cracks in the ice. They dispersed, defeated, and soon the sunlight shone onto a newly empty oasis once more.

The sister had liberated her home. She did it together with her new friend inside of her. They were a team now, inseparable after the revelation of such a beneficial symbiotic relationship. And so it was that in the midst of all the other microbes scurrying back into the oasis that their liberated had won back for them to call home in, the sister did not perform her final action alone.

Tick tick tick tick tick tick tick tick tick tick tick…

The eternal process slid along again. The sister's helices began to unravel twist by twist as her helicase enzyme slid down the rungs of her nucleotide ladder, unzipping the base pairs one by one. And the same process began to start within the Rickettsiale too, synched together with the motions of its host's mitosis. One after another, their DNA strands were copied within themselves. Their nucleotide ladders began to coil back onto themselves, and huddled together at the ends of their membranes. The Rickettsiale split into two new sisters first, and then those two sisters took their place on opposite ends of the archaea sister alongside her own DNA. The sister pulled on herself, the membrane competing in it's own tug of war. The membrane pinched together, tighter and tighter, each side encapsulating their own identical chemistry.

And then finally, sisters. Emergent new life born of their mothers. Not just daughters of the old archaea, but the Rickettsiale within. They travelled together, not as two organisms but as one with a common drive and a mutual benefit. Sisters had not been born this time. This time, a sisterhood was born. And it would be one on which a new, very different future for life could be built upon.

ATCATGCATACTAGAATCACGAGACAGCATCACCCAACAACACCCACACACCGACATACTAGAATCACGAGACAGATTACACACATAAGACATCATACAAAT